View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15574_high_6 (Length: 369)
Name: NF15574_high_6
Description: NF15574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15574_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 212 - 348
Target Start/End: Complemental strand, 7837187 - 7837051
Alignment:
| Q |
212 |
cagccgttagatctggatctatgataggtctttgagaagaaggtgcaagatgtggtggtggataaagattagtagtagtattatggttagggtgtgaatt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837187 |
cagccgttagatctggatctatgataggtctttgagaagaaggtgcaagatgtggtggtggataaagattagtagtagtattatggttagggtgtgaatt |
7837088 |
T |
 |
| Q |
312 |
ttgaggtgggttattgaagactaatgtgtgaacttga |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837087 |
ttgaggtgggttattgaagactaatgtgtgaacttga |
7837051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 16 - 142
Target Start/End: Complemental strand, 7837383 - 7837257
Alignment:
| Q |
16 |
caagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctaccacgtggcttcccatgcttgccgcgtggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837383 |
caagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctaccacgtggcttcccatgcttgccgcgtggt |
7837284 |
T |
 |
| Q |
116 |
ttctcagacattctcggtaacatattt |
142 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7837283 |
ttctcagacattctcggtaacatattt |
7837257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University