View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15574_low_10 (Length: 265)
Name: NF15574_low_10
Description: NF15574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15574_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 15 - 246
Target Start/End: Complemental strand, 43640245 - 43640014
Alignment:
| Q |
15 |
caaaggcaatgacatagaaaacgaaactcaaatgattatacttgaaaacgacaccgttaaacaacgtccctacgttcttcttttaccactcatcgaaggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43640245 |
caaaggcaatgacatagaaaacgaaactcaaatgattatacttgaaaacgacaccgttaaacaacgtccctacgttcttcttttaccactcatcgaaggt |
43640146 |
T |
 |
| Q |
115 |
tctttcagagcttgtcttcaaccaggagaaaacaataacaacgtggacatttgcatggaaagtggatccacacgtgttgttgaatcaactttcaaaacat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43640145 |
tctttcagagcttgtcttcaaccaggagaaaacaataacaacgtggacatttgcatggaaagtggatccacacgtgttgttgaatcaactttcaaaacat |
43640046 |
T |
 |
| Q |
215 |
gtttatacattcatgcaaacttcgatccttat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43640045 |
gtttatacattcatgcaaacttcgatccttat |
43640014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University