View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15574_low_5 (Length: 387)
Name: NF15574_low_5
Description: NF15574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15574_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 126 - 348
Target Start/End: Original strand, 4600758 - 4600980
Alignment:
| Q |
126 |
attttaagttgtattgtgaattagatatcagaataaaaatacaaactgtccaatctctatctaacaaccgacatttaccggctgtagtgactgcaacgtt |
225 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4600758 |
attttaagttgtattgtgaatcagatatcagaataaaaatacaaactgtccgatctctatctaacaaccgacatttaccggctgtagtgactgcaacgtt |
4600857 |
T |
 |
| Q |
226 |
gaagttgtagtcgatctggattggtaagagagtataccaaactgtacaaatgtatcaagccaagttgatgcaatttcatataaaatcagtctctaagaaa |
325 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4600858 |
gaagttgtagtcaatctggattggtaagagagtataccaaactgtacaaatgtatcaagccaagttgatgcaatttcatataaaatcagtctctaagaaa |
4600957 |
T |
 |
| Q |
326 |
cgtagctatattacgacttatgg |
348 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
4600958 |
agtagctatattacgactcatgg |
4600980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 4600658 - 4600730
Alignment:
| Q |
5 |
tgtcgaagaatatgtagaatgagatgaaatgtaaactaatgttttacacaagagaccaattatgctaaaacaa |
77 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4600658 |
tgtcaaagaatatgtagaatgagatgaaatgtaaactaatgttttacacaagagaccaattatgctaaaacaa |
4600730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 5 - 78
Target Start/End: Original strand, 4592224 - 4592296
Alignment:
| Q |
5 |
tgtcgaagaatatgtagaatgagatgaaatgtaaactaatgttttacacaagagaccaattatgctaaaacaat |
78 |
Q |
| |
|
|||| |||||||||||||||||||| || | || || |||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
4592224 |
tgtcaaagaatatgtagaatgagattaa-tctagaccaatgttttactctagagaccaattatgctaaagcaat |
4592296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University