View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15575_high_25 (Length: 304)
Name: NF15575_high_25
Description: NF15575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15575_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 9877718 - 9877484
Alignment:
| Q |
19 |
agaatgacctgaaggaaagatttaccgaagacacgaatggtgggtctggtccatgggatgtgtttatcgaggtaattgaaccatttccatgattgttctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877718 |
agaatgacctgaaggaaagatttaccgaagacacgaatagtgggtctggtccatgggatgtgtttatcgaggtaattgaaccatttccatgattgttctg |
9877619 |
T |
|
| Q |
119 |
aaggtattaacctctgaatcaatacgacgtcgcttccgttaccgagatcaatagtctcagatttctttgcggtttcgttagggtttggttctgacaccgc |
218 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877618 |
aaggtattaatctctgaatgaatacgacgtcgcttccatttccgagatcaatagtctcagatttctttgcggtttcgttagggtttggttctgacaccgc |
9877519 |
T |
|
| Q |
219 |
ctttagcttcaaggtgctcattgatgacgatgatg |
253 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9877518 |
ctttagcttcaaggtgctcattgatgatgatgatg |
9877484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 240 - 279
Target Start/End: Complemental strand, 9877479 - 9877440
Alignment:
| Q |
240 |
tgatgacgatgatgccattgtagtagaatgttcattactt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877479 |
tgatgacgatgatgccattgtagtagaatgttcattactt |
9877440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University