View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15575_high_28 (Length: 253)
Name: NF15575_high_28
Description: NF15575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15575_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 33485177 - 33484985
Alignment:
| Q |
1 |
cctcacggccaaacctcgaaggttaacacaagaagaaaattgagttttagattaattagttcaacaatcaaggtgcaatcaaagagactaatcattgtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33485177 |
cctcacggccaaacctcgaaggttaacacaagaagaaaattgagttttagattaattagttcaacaatcaa-----------agagactaatcattgtaa |
33485089 |
T |
|
| Q |
101 |
atgatccaagtttgacattgtattcgggcctggtccctacctacggtaacaagaaggatccaagtttaagaaccctaggggatctagtgcatcaaaaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33485088 |
atgatccaagtttgacattgtattcgggcctggtccctaactacggtaacaagaaggatccaagtttaagaaccctaggggatctagtgcatgaaaaact |
33484989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 81 - 178
Target Start/End: Complemental strand, 33497882 - 33497785
Alignment:
| Q |
81 |
aaagagactaatcattgtaaatgatccaagtttgacattgtattcgggcctggtccctacctacggtaacaagaaggatccaagtttaagaaccctag |
178 |
Q |
| |
|
||||| ||||||||| ||||| |||||| |||||||||||||| |||||| | |||||| ||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
33497882 |
aaagatactaatcatagtaaacgatccatgtttgacattgtatacgggccagatccctatctatggtaacaagaaggatcgaattttaagaaccctag |
33497785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University