View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15575_high_44 (Length: 226)
Name: NF15575_high_44
Description: NF15575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15575_high_44 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 92 - 226
Target Start/End: Complemental strand, 46159600 - 46159466
Alignment:
| Q |
92 |
tttgcaccactatgctagctcggctccccaggcctttgcacctcttttcagaacatgcataatcaatcatagataagtggaaacagaagcttcattttcc |
191 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
46159600 |
tttgcaccactatgctagctcagctccacaggcctttgcacctcttttctgaacatgcataatcaatcatagatgagttgaaacagaagcttcattttcc |
46159501 |
T |
|
| Q |
192 |
tcattttatgtttgattttcagtatgttgtccttt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46159500 |
tcattttatgtttgattttcagtatgttgtccttt |
46159466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 46159775 - 46159679
Alignment:
| Q |
1 |
tttctaaagcaagaagcgagaaagttacggttcggattacaacaatactctggagcagtactgcgggggttgtcgccccagtaacaaacagtttgca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46159775 |
tttctaaagcaagaagcgagaaagttacggttcggattacaacaatactctggagcagtactgcgggggttgtcgcccccgtaacaaacagtttgca |
46159679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 133
Target Start/End: Complemental strand, 46159634 - 46159593
Alignment:
| Q |
92 |
tttgcaccactatgctagctcggctccccaggcctttgcacc |
133 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46159634 |
tttgcaccactatgctagctcagctccccaggcctttgcacc |
46159593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 46166519 - 46166446
Alignment:
| Q |
102 |
tatgctagctcggctccccaggcctttgcacctcttttca-gaacatgcataatcaatcatagataagtggaaa |
174 |
Q |
| |
|
||||||||||| || ||||| |||||||| |||||||| | | ||||||||||| |||||||||| ||| |||| |
|
|
| T |
46166519 |
tatgctagctcagccccccatgcctttgcccctctttttatgcacatgcataattaatcatagatgagttgaaa |
46166446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University