View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15575_low_27 (Length: 303)
Name: NF15575_low_27
Description: NF15575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15575_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38720953 - 38721180
Alignment:
| Q |
1 |
gggaaatgagtttcaggattgagaagggtaacattggtgacaagaccgtaacccctcgacactgttatgctagcttgataacgctgagcacaattgatta |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38720953 |
gggaaatgagttttaggattgagaagggtaacattggtgacaagaccgtaacccctcgacactgttatgctagcttgataacgatgagcacaattgatta |
38721052 |
T |
|
| Q |
101 |
tttcccccacaatatcttttccagaggggatctcaatgtaaatcattttcatattgttgtcc------tgatcaatattcacaggtggtttaggcttgtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
38721053 |
tttcccccacaatatcttttccagaggggatctcaatgtaaatcattttcatattgttgtccatgttttcctcaatattcacaggtggtttaggcttgtt |
38721152 |
T |
|
| Q |
195 |
cttagatcccgggggtctacccctaggc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38721153 |
cttagatcccgggggtctacccctaggc |
38721180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 235 - 286
Target Start/End: Original strand, 38721217 - 38721271
Alignment:
| Q |
235 |
atcaatgtgacattgttgttgttg---gtggtggtaatgtgagagaccatgtttc |
286 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38721217 |
atcaatgtgtcattgttgttgttgtttgtggtggtaatgtgagagaccatgtttc |
38721271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University