View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15575_low_40 (Length: 239)
Name: NF15575_low_40
Description: NF15575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15575_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 29064773 - 29064985
Alignment:
| Q |
18 |
agattccttagtggataaatgatttctggtctagtaggctcttaaggttgtctttacatcaaaattaatttttgaatacatcttattgattacaatatag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29064773 |
agattccttagtggataaatgatttctggtctagtacgctcttaaggttgtctttacatcaaaattaatttttgagtacatcttattgattacaatatag |
29064872 |
T |
|
| Q |
118 |
cttatatttttctatttcaaaatgtaggagcaagatggattaacttgttccagtgttagccctgcagtaggaaatgtagctggatcacatcctgttactc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29064873 |
cttatatttttctatttcaaaatgtaggagcaagatggattaacttgttccagtgttagccctgcagtaggaaatgtagctggatcacatcctgttactc |
29064972 |
T |
|
| Q |
218 |
atattcatctcag |
230 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
29064973 |
atattcaactcag |
29064985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University