View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15575_low_44 (Length: 227)
Name: NF15575_low_44
Description: NF15575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15575_low_44 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31835959 - 31836186
Alignment:
| Q |
1 |
ttatagacaacgagcttcttctcagagaattgattcttccatcttttcatctattgtatggttactatgttttgtaatgtaacacatttttcaagttttg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31835959 |
ttatagacaacaagcttcttctcagagaattgattcttccatcttttcatctattgtatggttactatgttttgtaatgtaacacatttttcaagttttg |
31836058 |
T |
|
| Q |
101 |
tctcatgcaaaggatgatatatatgaggtatcacatttttcaagttttgtcttatgcaaaggatgatccatatgagaaagagctacgtgtgtacaattaa |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31836059 |
tctcatgcaaaggatgatacatatgaggtatcacatttttcaagttttgtcttatgcaaaggatgatacatatgagaaagagctacgtgtgtacaattaa |
31836158 |
T |
|
| Q |
201 |
ccaatatgtcac-aaattggttcatctc |
227 |
Q |
| |
|
|||||||||||| |||||||||| |||| |
|
|
| T |
31836159 |
ccaatatgtcacaaaattggttcttctc |
31836186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University