View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15576_low_2 (Length: 494)
Name: NF15576_low_2
Description: NF15576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15576_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 202 - 484
Target Start/End: Original strand, 46597205 - 46597487
Alignment:
| Q |
202 |
ggaccggatggtctgaatcctgctttttaccaccgtttttggaaggaattaggtggagaaatattttatgttgcttcctcttggctcacttctagttcct |
301 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
46597205 |
ggaccggatggtctgaattctgctttttaccaccgtttttggaaggaattaggtggagaaatattttttgttgcttcctcttggctcacttctggttcct |
46597304 |
T |
 |
| Q |
302 |
ttccccctgagttgaatgccacacacatcgtgctcgctccaaaggatgattacccggaatatatgaaagaccttcgccctatctccctctttaatatcct |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
46597305 |
ttccccctgagttgaatgccacacacatcgtgctcgctccaaagggtgataacccggaatatatgaaagaccttcgccctatctccctctgtaatgtcct |
46597404 |
T |
 |
| Q |
402 |
atacaaaattatttctaaggtgctggctaaccgccttcgccctttgattgataaatggatatctacagaacaagctgcctttg |
484 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46597405 |
atataaaattatttctaaggtgctggctaaccgccttcgccctttgattgataaatggatatctacagaacaagctgcctttg |
46597487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 16860599 - 16860678
Alignment:
| Q |
154 |
caagaatttcatgaagcaatatttaatatgcatcctgataaatcccccggaccggatggtctgaatcctgctttttacca |
233 |
Q |
| |
|
||||||||| | || ||||| |||| ||||||||| |||||||| || || ||||||||||| ||||| || |||||||| |
|
|
| T |
16860599 |
caagaatttaaagaggcaatttttagtatgcatccggataaatctccgggtccggatggtctaaatccagcattttacca |
16860678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 180 - 245
Target Start/End: Complemental strand, 9183428 - 9183363
Alignment:
| Q |
180 |
tatgcatcctgataaatcccccggaccggatggtctgaatcctgctttttaccaccgtttttggaa |
245 |
Q |
| |
|
||||||||| |||||||| || ||||| || ||||| ||||||||||||| |||||| || ||||| |
|
|
| T |
9183428 |
tatgcatccagataaatcacctggacctgacggtcttaatcctgcttttttccaccgattctggaa |
9183363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University