View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15580_high_2 (Length: 411)
Name: NF15580_high_2
Description: NF15580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15580_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 13 - 391
Target Start/End: Complemental strand, 2064214 - 2063837
Alignment:
| Q |
13 |
tgaaccggttgattatgacgttgaaggtaacagaattggtgaagaaattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064214 |
tgaaccggttgattatgacgttgaaggtaacagaattggtgaagagattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaac |
2064115 |
T |
 |
| Q |
113 |
atttaggtttataaatttcgatataannnnnnnnnnnnnaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggct |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064114 |
atttaggtttataaatttcgatataatttttttatttttaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggct |
2064015 |
T |
 |
| Q |
213 |
ttagaacaaaattaatgcaaatgagtagaggtatggtgattttgggatttagatcatgaatatttttaggaatgttaaattagatgaaatgatacaagga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
2064014 |
ttagaacaaaattaatgcaaatgagtagaggtatggtgattttgggatttagatcatgaatatttttaggaatgtt-aattagatgaaaagatacaagga |
2063916 |
T |
 |
| Q |
313 |
attataatattggatcttgtaaaaaggcgcaccaattatggataannnnnnnnctttctctatacaaaaatattatggg |
391 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2063915 |
attataatattggatcttgtaaaaagacgcaccaattatggataattttttttttctctctatacaaaaatattatggg |
2063837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University