View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15583_low_10 (Length: 218)
Name: NF15583_low_10
Description: NF15583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15583_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 42113092 - 42112945
Alignment:
| Q |
20 |
gaaggcatagatagggtttaattatgggccggatgggacagcggggataagaggaaacactttgatcaatgattaaatgtgttttgtttctctgtctccc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42113092 |
gaaggcatagatagggtttaattatgggccggatgggacagcggggataagaggaaacactttgatcaatgattaaatgtgttttgtttctctgtctccc |
42112993 |
T |
|
| Q |
120 |
cactactcccaaccggtgggagagaaacagctacgaaaaagatttggg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42112992 |
cactactcccaaccggtgggagagaaacagctgcgaaaaagatttggg |
42112945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University