View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15585_low_5 (Length: 283)
Name: NF15585_low_5
Description: NF15585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15585_low_5 |
 |  |
|
| [»] chr5 (8 HSPs) |
 |  |
|
| [»] chr8 (4 HSPs) |
 |  |
|
| [»] chr3 (7 HSPs) |
 |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] chr4 (4 HSPs) |
 |  |
|
| [»] scaffold1149 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 10029207 - 10029376
Alignment:
| Q |
19 |
ggttaacttgtgtaaatgtgaatatttgtagatatgacgtggtgaatgtatacacacacgaatacatgtttaatgaaaataagtaaagcaaatttaacgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10029207 |
ggttaacttgtgtaaatgtgaatatttgtagatatgacgtggtgaatgtatacacacatgaatacatgtttaatgaaaataagtaaagcaaatgtaacgt |
10029306 |
T |
 |
| Q |
119 |
tgctacactttacacacttcaattagccaccactttgnnnnnnngtgtgtgcacatttacaaggcactta |
188 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10029307 |
tgctacactttacacagttcaattagtcaccactttgtttttttgtgtgtgcacatttacaaggcactta |
10029376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 242 - 277
Target Start/End: Original strand, 16537539 - 16537574
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16537539 |
tttgaaccccagaccttgtatatattatgcattatc |
16537574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 242 - 277
Target Start/End: Complemental strand, 16628123 - 16628088
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16628123 |
tttgaaccccagaccttgtatatattatgcattatc |
16628088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 283
Target Start/End: Original strand, 2962733 - 2962770
Alignment:
| Q |
246 |
aaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2962733 |
aaccccgaaccttgcatatattatgcattatctttacc |
2962770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Complemental strand, 25251568 - 25251536
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
25251568 |
tttgaaccccaaaccttatatatattatgcatt |
25251536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 35396694 - 35396650
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||||||| ||||| |
|
|
| T |
35396694 |
ggatttgaaccccaaacgttatatattttatgcattatccttacc |
35396650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 27679559 - 27679515
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
27679559 |
ggatttgaaccccgaaccttgcatatattatgcattatctttacc |
27679515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 242 - 283
Target Start/End: Original strand, 14681257 - 14681298
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
14681257 |
tttgaaccccgaaccttctatatattatgcattatctttacc |
14681298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 3052242 - 3052198
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3052242 |
ggatttgaaccccaaaccttacatatattatgcattatccttacc |
3052198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 242 - 274
Target Start/End: Complemental strand, 30488983 - 30488951
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30488983 |
tttgaaccccaaaccttgtatatattatgcatt |
30488951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 276
Target Start/End: Complemental strand, 38756791 - 38756754
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattat |
276 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38756791 |
ggatttgaaccccgaaccttgtatatattatacattat |
38756754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 11647258 - 11647214
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
11647258 |
ggattcgaaccccaaaccttgcatatattatgcattgtccttacc |
11647214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 19248540 - 19248496
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||| |||| |
|
|
| T |
19248540 |
ggatttgaaccccaaacattgcatatattatgcattgtctatacc |
19248496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 277
Target Start/End: Original strand, 34987153 - 34987189
Alignment:
| Q |
241 |
atttgaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
34987153 |
atttgaaccccgaaccttggatatattatgcattatc |
34987189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 236 - 277
Target Start/End: Original strand, 8211595 - 8211636
Alignment:
| Q |
236 |
cctggatttgaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8211595 |
cctggatttgaaccccgaactttgtatatattatgcattatc |
8211636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 14918303 - 14918335
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
14918303 |
tttgaaccccagaccttgtatatattatgcatt |
14918335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 283
Target Start/End: Original strand, 27571849 - 27571893
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
27571849 |
ggatttgaaccccaaaccttgcatatattatgcattgtctgtacc |
27571893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Complemental strand, 5179851 - 5179810
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || ||||| |
|
|
| T |
5179851 |
tttgaaccccgaaccttgtatatattatgcattgtccttacc |
5179810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 15021624 - 15021661
Alignment:
| Q |
240 |
gatttgaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
15021624 |
gatttgaacctcaaaccttgtatattttatgcattatc |
15021661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Complemental strand, 16392629 - 16392597
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
16392629 |
tttgaaccccaaaccttgtatattttatgcatt |
16392597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 48376896 - 48376852
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48376896 |
ggattcgaaccccaaaccttacatatattatgcattatctttacc |
48376852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Complemental strand, 2078298 - 2078257
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
2078298 |
tttgaaccccaaaccttgcatatattatgcattgtctctacc |
2078257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 276
Target Start/End: Original strand, 47099035 - 47099072
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattat |
276 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
47099035 |
ggatttgaaccccgaaccttgcatatattatgcattat |
47099072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 20612280 - 20612312
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
20612280 |
tttgaaccccaaaccttgcatatattatgcatt |
20612312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Complemental strand, 38221786 - 38221754
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
38221786 |
tttgaaccccaaactttgtatatattatgcatt |
38221754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Original strand, 48315024 - 48315068
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
48315024 |
ggatttgaaccccggaccttgcatatattatgcattatccttacc |
48315068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 52454980 - 52455012
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
52454980 |
tttgaaccccgaaccttgtatatattatgcatt |
52455012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 239 - 274
Target Start/End: Original strand, 25603911 - 25603946
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25603911 |
ggatttgaaccccaaaccttatatatattatgcatt |
25603946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 239 - 274
Target Start/End: Complemental strand, 31477032 - 31476997
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31477032 |
ggatttgaaccccgaaccttgtatatattatgcatt |
31476997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 276
Target Start/End: Original strand, 34364502 - 34364532
Alignment:
| Q |
246 |
aaccccaaaccttgtatatattatgcattat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34364502 |
aaccccaaaccttgtatatattatgcattat |
34364532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 276
Target Start/End: Original strand, 42372158 - 42372188
Alignment:
| Q |
246 |
aaccccaaaccttgtatatattatgcattat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42372158 |
aaccccaaaccttgtatatattatgcattat |
42372188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Complemental strand, 30243308 - 30243267
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
30243308 |
tttgaaccccgaaccttgtatatattatgcattgtctctacc |
30243267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 9547412 - 9547444
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
9547412 |
tttgaaccccaaaccttgcatatattatgcatt |
9547444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 18611966 - 18611998
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
18611966 |
tttgaaccccaaaccttgcatatattatgcatt |
18611998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Original strand, 20120721 - 20120765
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| || ||||| |
|
|
| T |
20120721 |
ggatttgaaccccgaaccttgcatatattatgcattgtccttacc |
20120765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 29896297 - 29896329
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
29896297 |
tttgaaccccaaaccttgcatatattatgcatt |
29896329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 239 - 277
Target Start/End: Original strand, 34599919 - 34599957
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
34599919 |
ggattcgaaccccaaaccttatatatattatgcattatc |
34599957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 3157720 - 3157752
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
3157720 |
tttgaacctcaaaccttgtatatattatgcatt |
3157752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 24978305 - 24978261
Alignment:
| Q |
239 |
ggatttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||| |||| |
|
|
| T |
24978305 |
ggatttgaaccctaaaccttgcatatattatgtattatctatacc |
24978261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 282
Target Start/End: Complemental strand, 27127282 - 27127242
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatctttac |
282 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
27127282 |
tttgaacgccagaccttgtatatattatgcattatccttac |
27127242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 245 - 281
Target Start/End: Complemental strand, 35527973 - 35527937
Alignment:
| Q |
245 |
gaaccccaaaccttgtatatattatgcattatcttta |
281 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35527973 |
gaaccccaaaccttatatatattatgcattattttta |
35527937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 245 - 277
Target Start/End: Complemental strand, 42416858 - 42416826
Alignment:
| Q |
245 |
gaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
42416858 |
gaaccccaaaccttgcatatattatgcattatc |
42416826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 281
Target Start/End: Original strand, 7377 - 7418
Alignment:
| Q |
240 |
gatttgaaccccaaaccttgtatatattatgcattatcttta |
281 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
7377 |
gatttgaacccccaaccttgcatatcttatgcattatcttta |
7418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Complemental strand, 6087805 - 6087764
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcattatctttacc |
283 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
6087805 |
tttgaaccccagaccttgcatatattatgcattatctatacc |
6087764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 8974976 - 8975017
Alignment:
| Q |
237 |
ctggatttgaaccccaaaccttgtatatattatgcattatct |
278 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
8974976 |
ctgggtttgaaccctaaaccttatatatattatgcattatct |
8975017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 38939535 - 38939572
Alignment:
| Q |
240 |
gatttgaaccccaaaccttgtatatattatgcattatc |
277 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
38939535 |
gatttgaaccccagaccttatatatattatgcattatc |
38939572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Original strand, 47015571 - 47015603
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
47015571 |
tttgaaccccagaccttgtatatattatgcatt |
47015603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1149 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1149
Description:
Target: scaffold1149; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 274
Target Start/End: Complemental strand, 2390 - 2358
Alignment:
| Q |
242 |
tttgaaccccaaaccttgtatatattatgcatt |
274 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
2390 |
tttgaaccccaaaccttgcatatattatgcatt |
2358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University