View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15585_low_7 (Length: 247)
Name: NF15585_low_7
Description: NF15585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15585_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 8 - 180
Target Start/End: Original strand, 45893721 - 45893890
Alignment:
| Q |
8 |
atgaagtcatacttgaggagaacccttcaactgttactgttattagtcaacaatctaagagaatgtcaaatctcaaatagctaccatgataatgttagaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45893721 |
atgaagtcatacttgaggagaacccttcaactgttactgttattagtcaacaatctaagagaatgtcaaatctcaaatagctaccatgataatgttagaa |
45893820 |
T |
 |
| Q |
108 |
agaaagnnnnnnnnngttattctttccgggttctcaaatgatctggtatttctagccaatgcatggcaatatg |
180 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45893821 |
agaaag---aaaaaagttattctttccggtttctcaaatgatccggtatttctagccaatgcatggcaatatg |
45893890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University