View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_high_15 (Length: 306)
Name: NF15587_high_15
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 39099442 - 39099732
Alignment:
| Q |
1 |
ctaatactcatagaagaatccttctctagggtcctcctctcacttttgggagtctgcagatctaactttccaacttcttcaaccaattatttattaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39099442 |
ctaatactcatagaagaatccttctctagggtcctcctctcacttttgggagcctgcagatctaactttccaacttcttcaaccaattatt-attaagat |
39099540 |
T |
 |
| Q |
101 |
tttatatagaatttattctgctgcagatctaacttagtgccaactttttgttgaaatatatttgtaaattaatgtgctttatgaaaactgaatttcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39099541 |
tttatatagaatttattctgctgcagatctaacttagtgccaactttttgatgaaatatatttgtaaattaatgtgctttatgaaaactgaatttcaaat |
39099640 |
T |
 |
| Q |
201 |
atgcataattattattcactcatctatagtttggcaacttattcttgtaagttgtaagcaaacggctagtactattattcttcttagtatta |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39099641 |
atgcataattattattcactcatctatagtttggcaacttattcttgtaagttgtaagcaaacggctagtactattattcttcttagtatta |
39099732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University