View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_high_17 (Length: 250)
Name: NF15587_high_17
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 5235036 - 5234829
Alignment:
| Q |
22 |
gagcttgacttgttgaagctatctgatctgaagctacattgttgtacctataatcagaactgaaagaaagggacacaagttaaaacatatatataaaggt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5235036 |
gagcttgacttgttgaagctatctgatctgaagctacattgttgtacctataatcagaactgaaagaaagggacacaagttaaaacatatatataaaggt |
5234937 |
T |
 |
| Q |
122 |
ggattcaaatgattagaacactgaaagcaatgttttaaaaattggaccgaactgaccgatttaattggttgaattgggaacgagtcggttta-ccatttg |
220 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| ||||| |||| ||||||| |||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
5234936 |
ggattcaaatggttagaatactgaaagcaatgttttaaaaaatggactgaaccgaccgatctaattggttgaagtgggaacgagtcggtttacccatttg |
5234837 |
T |
 |
| Q |
221 |
gtttgatc |
228 |
Q |
| |
|
||||||| |
|
|
| T |
5234836 |
ttttgatc |
5234829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University