View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_high_3 (Length: 720)
Name: NF15587_high_3
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 312; Significance: 1e-175; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 312; E-Value: 1e-175
Query Start/End: Original strand, 19 - 362
Target Start/End: Original strand, 28896474 - 28896817
Alignment:
| Q |
19 |
gaaagctcttttagagtaagtaaaattgtgtagataagatagttgaggaggcgaacttgtcctcttggaattggttgagtattaaatcgaataaccttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896474 |
gaaagctcttttagagtaagtaaaattgtgtagataagatagttgaggaggcgaacttgtcctcttggaattggttgagtattaaatcgaataaccttga |
28896573 |
T |
|
| Q |
119 |
ttataacatatcacaatggtgcctgaatccaatggcttgccttagtctctcgcgacaagatttgccttgtgttgatcttaaaatcaaggctagcgctgca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896574 |
ttataacatatcacaatggtgcctgaatccaatggcttgccttagtctgtcgcgacaagatttgccttgtgttgatcttaaaatcaaggctagcgctgca |
28896673 |
T |
|
| Q |
219 |
acttttggcgttgcaggtaggcagggttctatagtggggcaggacggatcttaagctagaaataggtagcagattttgtagttcttgtcttggtgaacct |
318 |
Q |
| |
|
| |||||||||||||||| ||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896674 |
agttttggcgttgcaggtgggcagggttctatggaggggcgggacggatcttaagctagaaataggtagcagattttgtagttcttgtcttggtgaacct |
28896773 |
T |
|
| Q |
319 |
gtgagtaaagcctgatgctattggacaacagttgcatctttaag |
362 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28896774 |
gggagtaaagcctgatgctattggacaagagttgcatctttaag |
28896817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 606 - 712
Target Start/End: Original strand, 28896822 - 28896928
Alignment:
| Q |
606 |
tttaggggatagtaaagagaatttaactatcacctatagagataaaaaagttattatcctgcatatgccatcaaaatatatattctcggtttgaacatta |
705 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896822 |
tttaggggataataaagagaatttaactatcacctatagagataaaaaagttattctcctgcatatgccatcaaaatatatattctcggtttgaacatta |
28896921 |
T |
|
| Q |
706 |
tattctt |
712 |
Q |
| |
|
| ||||| |
|
|
| T |
28896922 |
ttttctt |
28896928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University