View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_low_20 (Length: 257)
Name: NF15587_low_20
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 38482898 - 38482934
Alignment:
| Q |
213 |
tcaaagcagctgaccaagacttgagaactcctttgct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38482898 |
tcaaagcagctgaccaagacttgagaactcctttgct |
38482934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University