View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_low_22 (Length: 248)
Name: NF15587_low_22
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 238
Target Start/End: Original strand, 3990739 - 3990957
Alignment:
| Q |
20 |
actggagactgcaagagttttccccatcaaacaaacatgtttatatattggacgatcatgtcttctgagccatgtttttaatcttccttcaggtatacga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990739 |
actggagactgcaagagttttccccatcaaacaaacatgtttatatattggacaatcatgtcttctgagccatgtttttaatcttccttcaggtatacga |
3990838 |
T |
 |
| Q |
120 |
tatttgccactcatatggagaatatagcggaattagcaacaatctatcccaacgtgaaaattctccactttcatgtcgaattaaaaaacaaccatttgga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990839 |
tatttgccactcatatggagaatatagcggaattagcaacaatctatcccaacgtgaaaattctccactttcatgtcgaattaaaaaacaaccatttgga |
3990938 |
T |
 |
| Q |
220 |
gttcaaggtagtatctctg |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3990939 |
gttcaaggtagtatctctg |
3990957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University