View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_low_23 (Length: 245)
Name: NF15587_low_23
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 9086355 - 9086578
Alignment:
| Q |
1 |
aattatgatgaaaaagtggcaccaaatccatatataaagaccgatatcactcttctgctttaaagaaaaaactgcatctttgatttctacaaatgaaggc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9086355 |
aattatgatgaaaaagtgccaccaaatccatatataaagaccaatatcactcttctgctttaaagaaaaaactgcatctttgatttctacaaatgaaggc |
9086454 |
T |
 |
| Q |
101 |
ttaggtaagtttagcatttttcattttagtcaccatagttggaatagaatctaccactattattcatagctctgacattaggggtagcaaaaatgtcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9086455 |
ttaggtaagtttagcatttttcattttagtcaccatagttggaatagaatctaccactattattcatagccctgacattaggggtagcaaaaatgtcaga |
9086554 |
T |
 |
| Q |
201 |
taaatgctatggacatgtctcaat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9086555 |
taaatgctatggacatgtctcaat |
9086578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University