View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_low_25 (Length: 203)
Name: NF15587_low_25
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 64 - 189
Target Start/End: Complemental strand, 39339852 - 39339728
Alignment:
| Q |
64 |
tgtcttgaaaaatactaaatgtttaagggtcttgnnnnnnnnntggcataaatatttaaaaggtggtgtagtttattctcaattactcaagttccttctt |
163 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||| || ||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39339852 |
tgtcttgaaaaatactatatgtttaagggtcttgaaaaaaaa-tggcatgaacattcaagaggtggtgtagtttattctcaattactcaagttccttctt |
39339754 |
T |
|
| Q |
164 |
tactttttatcataaggtggtggatg |
189 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
39339753 |
tattttttatcataaggtggtggatg |
39339728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 39339890 - 39339943
Alignment:
| Q |
1 |
aaatttatatgagaatcatgtaatttactgtaatccatgtgaattttaactcat |
54 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39339890 |
aaatttatatgagaatcacgtaatttactgtaatccatgtgaattttaactcat |
39339943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University