View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15587_low_26 (Length: 202)
Name: NF15587_low_26
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15587_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 39339914 - 39339728
Alignment:
| Q |
1 |
aattacatgattctcatataaatttagttgaatttatgtgaattttaactcatnnnnnnnnntgtcttgaaaaatactaaatgtttaagggtcttgnnnn |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
39339914 |
aattacgtgattctcatataaatttagttgaatttatgtgaattttaactcataaaaaaaaatgtcttgaaaaatactatatgtttaagggtcttgaaaa |
39339815 |
T |
 |
| Q |
101 |
nnnnntggcataaatatttaaaaggtggtgtagtttattctcaattactcaagttccttctttactttttatcataaggtggtggatg |
188 |
Q |
| |
|
|||||| || ||| || |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39339814 |
aaaa-tggcatgaacattcaagaggtggtgtagtttattctcaattactcaagttccttctttattttttatcataaggtggtggatg |
39339728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 48
Target Start/End: Complemental strand, 27667060 - 27667027
Alignment:
| Q |
15 |
catataaatttagttgaatttatgtgaattttaa |
48 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
27667060 |
catataaatttagtagaatttatgtgaattttaa |
27667027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University