View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15588_low_12 (Length: 209)
Name: NF15588_low_12
Description: NF15588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15588_low_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 6467725 - 6467516
Alignment:
| Q |
1 |
tccacagagtgaaatctaacatggttagtgccaaactatcttgacattctcactttcattttctttgaatattatctccttttata-accatatgttcat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6467725 |
tccacagagtgaaatctaacatggttagtgccaaactatcttgacattctcactttcattttctttgaatattatctccttttatataccatatgttcat |
6467626 |
T |
|
| Q |
100 |
tattatttttcatggcagatttgtgttttgaaagtggatacttattatgatggatggtttcaaactatcttcaaaatactgaggaaaatcaaaggtatgt |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6467625 |
tattatttttcatggcagatttgtgctttgaaagtggatacttattatgatggatggtttcaaactatcttcaaaatactgaggaaaatcaaaggtatgt |
6467526 |
T |
|
| Q |
200 |
tttttgtctc |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
6467525 |
tttttgtctc |
6467516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University