View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15588_low_13 (Length: 201)
Name: NF15588_low_13
Description: NF15588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15588_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 25 - 185
Target Start/End: Original strand, 21114416 - 21114576
Alignment:
| Q |
25 |
cctgtatttttcacatatattttgtacatgacaagcactaacatgtttctttgtcatcaagaaattaagtgaccaaaccatatataccgtaatgatggat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21114416 |
cctgtatttttcacatatattttgtacatgacaagcactaacatgtttctttgtcatcaagaaattaagtgaccaaaccatatttaccgtaatgatggat |
21114515 |
T |
|
| Q |
125 |
ctttgactgatttgtgtacacgattctgttatcaggttgtctttatttgatggcaaatatt |
185 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21114516 |
ctttgactaatttgtgtacacgattctgttatcaggttgtctttatttgatggcaaatatt |
21114576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 117 - 185
Target Start/End: Original strand, 21121935 - 21122003
Alignment:
| Q |
117 |
tgatggatctttgactgatttgtgtacacgattctgttatcaggttgtctttatttgatggcaaatatt |
185 |
Q |
| |
|
|||| |||||||||||| |||||| ||| |||| | ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
21121935 |
tgatagatctttgactggtttgtgcacatgattatattatcaggttgcctttacttgatggcaaatatt |
21122003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University