View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15588_low_7 (Length: 290)

Name: NF15588_low_7
Description: NF15588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15588_low_7
NF15588_low_7
[»] chr2 (1 HSPs)
chr2 (13-268)||(1329433-1329688)


Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 268
Target Start/End: Original strand, 1329433 - 1329688
Alignment:
13 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329433 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca 1329532  T
113 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329533 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 1329632  T
213 tgaagtcaaggcccttccaccaccagaggaaccagccgaagaagtggtggaagagc 268  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329633 tgcagtcaaggcccttccaccaccagaggaaccagccgaagaagtggtggaagagc 1329688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University