View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15589_high_39 (Length: 249)
Name: NF15589_high_39
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15589_high_39 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 53 - 236
Target Start/End: Complemental strand, 30719191 - 30719008
Alignment:
| Q |
53 |
tcttggaagtccaagatgcaatccacagtttcctccctatcaagttctgagctaaatattgtgctcttgctagcctctattatgaattgcactaattgca |
152 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30719191 |
tcttggaagtccaagatgcaatccacggtttcctccctatcaagttctgagctaaatattatgctcttgctagcctctattatgaattgcactggttgca |
30719092 |
T |
|
| Q |
153 |
acatttgtttgatgatctacgtattaaattttcacaacttgtcttctgacaacaaatatgcaatcatctccaccctattccttc |
236 |
Q |
| |
|
| |||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
30719091 |
atatttgtttcatgatctacgtattacattttcacaacttgtcttccgacaacaaatatgcaatcatctacaccctatcccttc |
30719008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 30719264 - 30719212
Alignment:
| Q |
1 |
aaattgggcatcatgccctgctgccggtcactttgtttatggtgactatgtat |
53 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
30719264 |
aaattgggcatcatgccctgctgcccgtcactttgtttatggttactatgtat |
30719212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University