View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15589_high_40 (Length: 248)
Name: NF15589_high_40
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15589_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 228
Target Start/End: Complemental strand, 45144254 - 45144039
Alignment:
| Q |
13 |
gagagaagaaagtggtgatctatacaacaacgttgagaggtgttcggaggacatttgaggcttgcaatgcggtgagagcagcttttgatgcatttggtgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144254 |
gagagaagaaagtggtgatctatacaacaacgttgagaggtgttcggaggacatttgaggcttgcaatgcggtgagagcagcttttgatgcatttggtgt |
45144155 |
T |
|
| Q |
113 |
acaaatatgcgagcgtgacgtttcgatggatagtgggtttaaagaggaactgagggagcttctgaaagagaagatggtgattccgccgagagtgtttgtg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45144154 |
acaaatatgcgagcgtgacgtttcgatggatagtgggtttaaagaggaactgagggagcttctgaaagagaagatggtggttccgccgagagtgtttgtg |
45144055 |
T |
|
| Q |
213 |
aagggatattatatcg |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45144054 |
aagggatattatatcg |
45144039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University