View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15589_high_41 (Length: 244)
Name: NF15589_high_41
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15589_high_41 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 161 - 244
Target Start/End: Complemental strand, 30719348 - 30719265
Alignment:
| Q |
161 |
cttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgactc |
244 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30719348 |
cttgaagtatttgaagagcttatcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgactc |
30719265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 239
Target Start/End: Complemental strand, 30701081 - 30700982
Alignment:
| Q |
140 |
ttttcaggcagctactcgtgtcttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgct |
239 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||| | ||| |||||||| ||||||| |
|
|
| T |
30701081 |
ttttcagaaagctactcatgtcttgaagtatttgaagagcttctcaacaaagggacttttcttcttggccaattctcctatgacgctatttgagtttgct |
30700982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 144 - 244
Target Start/End: Original strand, 33768523 - 33768623
Alignment:
| Q |
144 |
caggcagctactcgtgtcttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgact |
243 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| | | || || | ||||||||||||||| ||||||||| | ||||| | | |||||||||||||| |
|
|
| T |
33768523 |
caggctgctactcgtgtcttgaaatatttgaagagttgcccagcaaagggacttttcttctctgccaattctcctttgaagttgtctgggtttgctgact |
33768622 |
T |
 |
| Q |
244 |
c |
244 |
Q |
| |
|
| |
|
|
| T |
33768623 |
c |
33768623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 145 - 244
Target Start/End: Complemental strand, 35517494 - 35517395
Alignment:
| Q |
145 |
aggcagctactcgtgtcttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgactc |
244 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| | | || || | ||||||||||||||| ||||||||| | ||||| | | ||||||||||||||| |
|
|
| T |
35517494 |
aggctgctactcgtgtcttgaaaaatttgaagagttgcccagcaaagggacttttcttctctgccaattctcctttgaagttgtctgggtttgctgactc |
35517395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University