View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15589_high_48 (Length: 228)
Name: NF15589_high_48
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15589_high_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 44812899 - 44813109
Alignment:
| Q |
1 |
gggataaaacacctgcatgtaccnnnnnnnnctttctttctgtcctatatcaagattagatgcatcaactatttaaacaacagcgacttagtattatttt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44812899 |
gggataaaacacctgcatgtaccttttttttctttctttctgtcctatatcaagattagatgcatcaactatttaaacaacaacgacttagtattatttt |
44812998 |
T |
|
| Q |
101 |
atttgattttattataaatgaatagggattaatttggttctag-aatcaatggcttcttcccgcttcctctcctccttccgctctttcatggctgccata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44812999 |
atttgattttattataaatgaatagggattaatttggttctagaaatcaatggcttcttcccgcttcctctcctccttccgctctttcatggctgccata |
44813098 |
T |
|
| Q |
200 |
ccccatccacg |
210 |
Q |
| |
|
||||||||||| |
|
|
| T |
44813099 |
ccccatccacg |
44813109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University