View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15589_low_27 (Length: 348)
Name: NF15589_low_27
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15589_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 27844367 - 27844696
Alignment:
| Q |
1 |
cagtctttgtcctacctccaaccgtcatcatctccgctcgaaccggtttcgctaaaacagaccggattgcttgtgttaggtcatggttcagacccggacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27844367 |
cagtctttgtcctacctccaaccgtcatcatctcagctcgaaccggtttcgctaaaacagaccggattgcttgtgttagatcatggttcagacccggacg |
27844466 |
T |
 |
| Q |
101 |
ctcctcacaacacactgtcactttcatcctccgtggttctccttcctctttgccgcaataactcactgtcgcctcatctgattctcctggaaacggccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844467 |
ctcctcacaacacactgtcactttcatcctccgtggttctccttcctctttgccgcaataactcactgtcgcctcatctgattctcctggaaacggccat |
27844566 |
T |
 |
| Q |
201 |
atctcaactacctctgtagaattaactgaaccaggttctccgctgcacgaagaagaagactctccatcattgtgacgattcgccatttcatcagcttcct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844567 |
gtctcaactacctctgtagaattaactgaaccaggttctccgctgcacgaagaagaagactctccatcattgtgacgattcgccatttcatcagcttcct |
27844666 |
T |
 |
| Q |
301 |
tcttcaaccgtttcacgtgctgcaccactt |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27844667 |
tcttcaaccgtttcacgtgctgcaccactt |
27844696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University