View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15589_low_41 (Length: 252)

Name: NF15589_low_41
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15589_low_41
NF15589_low_41
[»] chr1 (1 HSPs)
chr1 (1-237)||(7816798-7817034)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 7816798 - 7817034
Alignment:
1 tcttgaagttagtcgttatggattcaaacatttacgaatagagagaaaaataaatagcaagagagcatgataaaaaataaatattgctgttttagtagta 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7816798 tcttgaagttggtcgttatggattcaaacatttacgaatagagagaaaaataaatagcaagagagcatgataaaaaataaatattgctgttttagtagta 7816897  T
101 tcttaaattgcgaatactaagacaaatannnnnnncaaaataacatgtaaataaaacagggaggaatatttttggattgaaacggtcatagatgcttctg 200  Q
    ||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
7816898 tcttaaattgcgaatactaagacaaatatttttttcaaaataacatgtaaataaaacagggaggaatatttttggattgaaacagtcatagatgcttctg 7816997  T
201 gtactggacatattttcaagtgaaaaatgtatcaact 237  Q
    |||||||||||||||||||||||||||||||||||||    
7816998 gtactggacatattttcaagtgaaaaatgtatcaact 7817034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University