View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15589_low_47 (Length: 244)

Name: NF15589_low_47
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15589_low_47
NF15589_low_47
[»] chr6 (3 HSPs)
chr6 (161-244)||(30719265-30719348)
chr6 (140-239)||(30700982-30701081)
chr6 (144-244)||(33768523-33768623)
[»] chr3 (1 HSPs)
chr3 (145-244)||(35517395-35517494)


Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 161 - 244
Target Start/End: Complemental strand, 30719348 - 30719265
Alignment:
161 cttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgactc 244  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30719348 cttgaagtatttgaagagcttatcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgactc 30719265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 239
Target Start/End: Complemental strand, 30701081 - 30700982
Alignment:
140 ttttcaggcagctactcgtgtcttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgct 239  Q
    |||||||  |||||||| ||||||||||||||||||||||||||||||| | |||||||||||||   ||||||||| | ||| |||||||| |||||||    
30701081 ttttcagaaagctactcatgtcttgaagtatttgaagagcttctcaacaaagggacttttcttcttggccaattctcctatgacgctatttgagtttgct 30700982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 144 - 244
Target Start/End: Original strand, 33768523 - 33768623
Alignment:
144 caggcagctactcgtgtcttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgact 243  Q
    ||||| ||||||||||||||||| ||||||||||| | | || || | ||||||||||||||| ||||||||| | ||||| | | ||||||||||||||    
33768523 caggctgctactcgtgtcttgaaatatttgaagagttgcccagcaaagggacttttcttctctgccaattctcctttgaagttgtctgggtttgctgact 33768622  T
244 c 244  Q
    |    
33768623 c 33768623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 145 - 244
Target Start/End: Complemental strand, 35517494 - 35517395
Alignment:
145 aggcagctactcgtgtcttgaagtatttgaagagcttctcaacagatggacttttcttctcttccaattctcatgtgaagctatttgggtttgctgactc 244  Q
    |||| |||||||||||||||||  |||||||||| | | || || | ||||||||||||||| ||||||||| | ||||| | | |||||||||||||||    
35517494 aggctgctactcgtgtcttgaaaaatttgaagagttgcccagcaaagggacttttcttctctgccaattctcctttgaagttgtctgggtttgctgactc 35517395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University