View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15589_low_49 (Length: 241)
Name: NF15589_low_49
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15589_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 5852885 - 5852689
Alignment:
| Q |
16 |
atcaacaagtttgtggtgcataatctagtctactcaacctaaaaacttggcatgttgaccaagacttctagctttgcgtgtaacatggatgatggaaaaa |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5852885 |
atcaacaagtttatggtgcataatctagtctactcaacttaaag--ttggcatgttgaccaagacttctagctttccgtgtaacatggatgatggaaaag |
5852788 |
T |
 |
| Q |
116 |
ggaatgctgtcaaatatataaatgtcaagaagcatagacttaattgattcaaaatatcagtttagagaaaggaaattactcactccatatcattttaaat |
215 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||||| |||||||||||||||||||||| ||||||||||| |||| |||||||| || ||||||||||| |
|
|
| T |
5852787 |
ggaatgctgccaaatatgtgaatgtcaagaagcat--acttaattgattcaaaatatcaatttagagaaagaaaatcactcactcaatgtcattttaaat |
5852690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 75
Target Start/End: Original strand, 5447809 - 5447867
Alignment:
| Q |
16 |
atcaacaagtttgtggtgcataatctagtctactcaacctaaaaacttggcatgttgacc |
75 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| || |||| ||| ||||||||||||||| |
|
|
| T |
5447809 |
atcaacaagtttgtggtgtataatctagcctaatc-accttaaatcttggcatgttgacc |
5447867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University