View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15589_low_52 (Length: 237)
Name: NF15589_low_52
Description: NF15589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15589_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 30709737 - 30709957
Alignment:
| Q |
1 |
atgtatctcttaaattttcacaatttccaataatatttggaaattataattgatttcattttattccttaattctttttatgatgtgtaatttaatcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30709737 |
atgtatctcttaaattttcacaatttccaataatatttggaaattataattgatttcattttattccttaattatttttatgatgtgtaatttaatcatg |
30709836 |
T |
 |
| Q |
101 |
caacatgtttagttcgatataaacttaattttgaactatttattaaatcagaaaggtttactctaata-attactatctaacatgagaatcacgtcttgt |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30709837 |
caacatg-ttagttcgatataaacttaattttgaactatttattaaatcagaaaggtttacacatatatattactatctaacatgagaatcacgtcttgt |
30709935 |
T |
 |
| Q |
200 |
actgttatggaaatattgtaac |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30709936 |
actgttatggaaatattgtaac |
30709957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University