View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1558_high_5 (Length: 238)
Name: NF1558_high_5
Description: NF1558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1558_high_5 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 5636452 - 5636676
Alignment:
| Q |
1 |
tggagtagctttacatttttcacaaaatcaaagcaagtaggaaacattattatttacttagtttcccatgtttaaaagtttatttagggcatgtttgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636452 |
tggagtagctttacatttttcacaaaatcaaagcaagtaggaaacattattatttacttagtttcccatgtttaaaagtttatttagggcatgtttgaat |
5636551 |
T |
 |
| Q |
101 |
tgacaacgagtttgacagtcgagatatgacactgatttttggaaaaatgtgcactttggtgtttaaacaaaatcacggtgccatcatgattttttcaaac |
200 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
5636552 |
tgacaa-------------cgagatatgactctgatttttggaaaaatgtgcactttggtgtttaagcaaaatcactgtgccatcatgattttttcaaac |
5636638 |
T |
 |
| Q |
201 |
tcaccgttgatccaaacatgcattgggtgtactagtat |
238 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5636639 |
tcaccgttgatccaaacatgcattggttgtactagtat |
5636676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 202
Target Start/End: Complemental strand, 3165525 - 3165489
Alignment:
| Q |
166 |
aacaaaatcacggtgccatcatgattttttcaaactc |
202 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
3165525 |
aacaaaatcacggtgtcatcatgattttgtcaaactc |
3165489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 222
Target Start/End: Complemental strand, 10734607 - 10734535
Alignment:
| Q |
150 |
tgcactttggtgtttaaacaaaatcacggtgccatcatgattttttcaaactcaccgttgatccaaacatgca |
222 |
Q |
| |
|
|||||||||| | || ||||||||||||||| ||| ||||||| |||||| || ||| ||||||||||||| |
|
|
| T |
10734607 |
tgcactttggagcttcaacaaaatcacggtgtcattgtgattttgtcaaacacattgttaatccaaacatgca |
10734535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 222
Target Start/End: Complemental strand, 38734275 - 38734219
Alignment:
| Q |
166 |
aacaaaatcacggtgccatcatgattttttcaaactcaccgttgatccaaacatgca |
222 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
38734275 |
aacaaaatcatggtgccatggtgattttgtcaaactcaccgtcaatctaaacatgca |
38734219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University