View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1558_low_10 (Length: 231)
Name: NF1558_low_10
Description: NF1558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1558_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 51 - 218
Target Start/End: Original strand, 12164240 - 12164407
Alignment:
| Q |
51 |
aatagtaataagaaaacagaaagctgaggaatcaaagcatgcatttcacctctcatatgtcacacatccctagattagaggtgactgatatgaaaagtca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12164240 |
aatagtaataagaaaacagaaagctgaggaaccaaagcatgcatttcacctctcatatgtcacacatccctagattagaggtgactgatatgaaaagtca |
12164339 |
T |
 |
| Q |
151 |
agctttatattataaataaaattaccctaaatatattcttttgtcttctttcacaaatttcatctcac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12164340 |
agctttatattataaataaaattaccctaaatatattcttttgtcttctttcataaatttcatctcac |
12164407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University