View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1558_low_13 (Length: 209)
Name: NF1558_low_13
Description: NF1558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1558_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 5636253 - 5636465
Alignment:
| Q |
1 |
tttctattaatcattgtatta----gtcattttcttattatgatggttaagtttgttctttgtaaaacatagcttagataaaccatcattctagtcatct |
96 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636253 |
tttctattaatcattgtattaattagtcattttcttattatgatggttaagtttgttctttgtaaaacatagcttagataaaccatcattctagtcatct |
5636352 |
T |
 |
| Q |
97 |
cagatcattgaattcagaattcttcactttcttctgattaaaccagtgttctacgagaacattagctaatgaagtatgcctattcacacttggttggttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636353 |
cagatcattgaattcagaattcttcactttcttctgattaaaccagtgttctacgaggacattagctaatgaagtatgcctattcacacttggttggttt |
5636452 |
T |
 |
| Q |
197 |
ggagtagctttac |
209 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5636453 |
ggagtagctttac |
5636465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University