View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1558_low_4 (Length: 328)
Name: NF1558_low_4
Description: NF1558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1558_low_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 7 - 328
Target Start/End: Original strand, 48947083 - 48947404
Alignment:
| Q |
7 |
gttcattgtgaaaaccatcactctctcttcgccgctccaaattccgtccatgaagttcaatatccccgatgaagttactgttgtagatgatttctcagtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48947083 |
gttcattgtgaaaaccatcactctctcttcgccgctccaaattccgtccatgaagttcaatatccccgatgaagttactgttgtggatgatttctcagtg |
48947182 |
T |
 |
| Q |
107 |
agataccgatcaagatcttcaacgacgattattgatttcggtgttgtttgatgtaggatggatttaagatctgaatcggttgaaattctggataggtcta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48947183 |
agataccgatcaagatcttcaacgacgattattgatttcggtgctgtttgaagtaggatggatttaagatctgaatcggttgaaattctggataggtcta |
48947282 |
T |
 |
| Q |
207 |
tgtagtagacgtcgtaagagagaaaattggccatggcggcaataaaactagattttccggtgccggaagaaccgtataaaaggaagctccgtttccagag |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48947283 |
tgtagtagacgtcgtaagagagaaaattggccatggcggcgataaaactagattttccggtgccggaagaaccgtataaaaggaagctccgtttccagag |
48947382 |
T |
 |
| Q |
307 |
acggccaaggcggtgatagtat |
328 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48947383 |
acggccaaggcggtgatagtat |
48947404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 227 - 303
Target Start/End: Complemental strand, 9516793 - 9516717
Alignment:
| Q |
227 |
agaaaattggccatggcggcaataaaactagattttccggtgccggaagaaccgtataaaaggaagctccgtttcca |
303 |
Q |
| |
|
|||||||| |||||||| |||| ||| |||||||||||||| ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
9516793 |
agaaaattcgccatggctgcaacaaagctagattttccggtaccggattcaccgtataacaagaagctccgtttcca |
9516717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University