View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1559-INSERTION-1 (Length: 238)
Name: NF1559-INSERTION-1
Description: NF1559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1559-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 8 - 201
Target Start/End: Original strand, 9609894 - 9610088
Alignment:
| Q |
8 |
taaggtttgtgagtttgattgtacatgcatggttgtttgtggataaattcgaaattgacttaaaatttt-aagtaaatttgagtgtaatctgaattattt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9609894 |
taaggtttgtgagtttgattgtacatgcatggttgtttgtgggtaaattcgaaattgacttaaaatttttaagtaaatttgggtgtaatctgaattattt |
9609993 |
T |
 |
| Q |
107 |
gtagtttctagctgcaaaactctaaccgagcaccttcattcaacaatgcaattttgttccaacaaaaaaatatctttgatccactttctccatag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9609994 |
gtagtttctagctgcaaaactctaaccgagcaccttcattcaacaatgcaattttgttccaacaaaaaaatatctttgatccactttctccatag |
9610088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University