View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1559-INSERTION-3 (Length: 227)
Name: NF1559-INSERTION-3
Description: NF1559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1559-INSERTION-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 48671451 - 48671239
Alignment:
| Q |
14 |
tgtcttcagaagacacagaaatcaaaccagaaattcatgtcctattggttgcgttttcagctcaaggtcacataaaccctttacttagactaggcaaatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48671451 |
tgtcttcagaagacacagaaatcaaaccagaaattcatgtcctattggttgcgttttcagctcaaggtcacataaaccctttacttagactaggcaaatc |
48671352 |
T |
|
| Q |
114 |
cctattaaccaaaggccttaatgtcacacttgccaccactgaattagtttaccaccgtgtcttcaaatcaaccaccaccgacacggacaccgtcccaact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48671351 |
cctattaaccaaaggccttaatgtcacacttgccaccactgaattagtttaccaccgtgtcttcaaatcaaccaccaccgacacagacaccgtcccaacc |
48671252 |
T |
|
| Q |
214 |
tcttactccacca |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48671251 |
tcttactccacca |
48671239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University