View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15592_high_4 (Length: 332)
Name: NF15592_high_4
Description: NF15592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15592_high_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 12 - 332
Target Start/End: Original strand, 28988030 - 28988347
Alignment:
| Q |
12 |
cataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtatccaaaacgcaccggtgtctgacactgacaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28988030 |
cataggtagtgagttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtgtccaaaacgcaccggtgtctgacactgacaca |
28988129 |
T |
|
| Q |
112 |
acacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtctaagttagaattttggagcttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28988130 |
acacctacacataaatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtataagttagaattttggagcttt |
28988229 |
T |
|
| Q |
212 |
aaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtacattgattatgttaatgatgcttccgggttctgattt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
28988230 |
aaataattgtagtgtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtac---gattatgttaatgatgcttctgggttctgattt |
28988326 |
T |
|
| Q |
312 |
tgagccctgttattttgtggc |
332 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28988327 |
tgagccctgttattttgtggc |
28988347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 133 - 162
Target Start/End: Original strand, 44572654 - 44572683
Alignment:
| Q |
133 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44572654 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
44572683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University