View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15593_high_11 (Length: 213)
Name: NF15593_high_11
Description: NF15593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15593_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 74 - 203
Target Start/End: Original strand, 4795558 - 4795687
Alignment:
| Q |
74 |
gccgcgactcatggttgattgtgaaaggaatgacgtgtcgccgcctgcgaccagttgatccatgaagttggtttcgtcatcgacggctgttaggcagtga |
173 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4795558 |
gccgcgactcatggttaattgtgaaaggaatgacgtgtcgccgcctgcgaccagttgatccatgaagttggtttcgtcatcgacggctgttaggcagtga |
4795657 |
T |
|
| Q |
174 |
agtccaaggcatccattattctgtgctgct |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
4795658 |
agtccaaggcatccattattctgtgatgct |
4795687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University