View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15593_low_10 (Length: 263)
Name: NF15593_low_10
Description: NF15593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15593_low_10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 263
Target Start/End: Complemental strand, 32853090 - 32852838
Alignment:
| Q |
13 |
aatatgcggttatattcaatcacttggttatggagacccaaaaaatctaaaaactgannnnnnn--cttcttataataaggaccaggaagtattgtattt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
32853090 |
aatatgcggttatattcaatcacttggttatggagacccaaaaaatctaaaaactgatttttttttcttcttataataaggacgaggaagtattgtattt |
32852991 |
T |
|
| Q |
111 |
gaccataagtttaggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852990 |
gaccataagtttaggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcag |
32852891 |
T |
|
| Q |
211 |
ttttgcttttaataccctgttgtatccacattattctgtagcagtgtctttca |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852890 |
ttttgcttttaataccctgttgtatccacattattctgtagcagtgtctttca |
32852838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University