View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15593_low_11 (Length: 248)
Name: NF15593_low_11
Description: NF15593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15593_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 5576835 - 5576619
Alignment:
| Q |
16 |
atgtacatttgaagatatttttatannnnnnn-ataaatttaaagactttagtgacaaatacaacaaggaccaaagtgaattatacttgctataattttg |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5576835 |
atgtacatttgaagatatttttatattttttttataaatttaaaggctttagggacaaatacaacaaggaccaaagtgaattatacttgctataattttg |
5576736 |
T |
|
| Q |
115 |
ttttagtaaaaatgaatagggtgagttagtttttctcattgttacagtctaatggtttgattgtgaggatattttatgtaaaattttaggtttgaattca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5576735 |
ttttagtaaaaatgaatagggtgagttagtgtttctcattgttacagtctaatagtttgattgtgaggatattttatgtaaaattttaggtttgaattca |
5576636 |
T |
|
| Q |
215 |
tattaggacattcctct |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5576635 |
tattaggacattcctct |
5576619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University