View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15594_high_9 (Length: 221)
Name: NF15594_high_9
Description: NF15594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15594_high_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 4586512 - 4586713
Alignment:
| Q |
20 |
tctttcattgatttactaatcattctatcgttattattcctatttttcatgataataagattatttcatgctagattcctcgcactgttattatttttaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4586512 |
tctttcattgatttactaatcattctatcgttattattcctatttttcatgataataagattatttcatgctagattcctcgcactgttattatttttaa |
4586611 |
T |
 |
| Q |
120 |
agatcaaaattgaagatgcatagaatttagggatctgcagtgaaccatttatactttcttctgccaactacctcaaactatatttagtgttttcgttaag |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4586612 |
agatcataattgaagatgcatagaatttagggatctgcagtgaactatttatactttcttctgctaactacctcaaactatatttagtgttttcgttaag |
4586711 |
T |
 |
| Q |
220 |
ta |
221 |
Q |
| |
|
|| |
|
|
| T |
4586712 |
ta |
4586713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University