View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15594_low_4 (Length: 425)
Name: NF15594_low_4
Description: NF15594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15594_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 19 - 425
Target Start/End: Original strand, 35872695 - 35873101
Alignment:
| Q |
19 |
caaggttcaccacctttcttcaatattactctctcatagtactttgatatcaattctgtgtacctgttaggatttagatgatatacttatccctatgtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35872695 |
caaggttcaccacctttcttcaatattactctctcatagtactttgatatcaattctgtgtacctgttaggatttagatgatatacttatccctatgtat |
35872794 |
T |
 |
| Q |
119 |
cnnnnnnnnnnnnagttgcgatttgtgattttcagttaattactatcaatctgaccttttcatgctcattacaggaagttcaagaggctgtccacaattg |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35872795 |
ctttttgttttttagttgcgatttgtgattttcagttaattactatcaatctgaccttttcatgctcattacaggaagttcaagaggctgtccacaatcg |
35872894 |
T |
 |
| Q |
219 |
agttgtcggactttggctgttttataattgtggcttgtggaatcaccgttttgcagcaaataggtatagttataatctgcttccattgtcgtatcttaca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35872895 |
agttgtcggactttggctgttttataattgtggcttgtggaatcaccgttttgcagcaaataggtatagttataatctgcttccattgtcgtatcttaca |
35872994 |
T |
 |
| Q |
319 |
catttcctttttgtggtgatcaggttctgtttctttatactgaaatttgtgttatgctcagcactcgtaattttatcgttgttttagatatcagcttaat |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35872995 |
catttcctttttgtggtgatcaggttctgtttctttatactgaaatttgtgttatgctcagcactcgtaattttatcgttgttttagatatcagcttaat |
35873094 |
T |
 |
| Q |
419 |
atatcac |
425 |
Q |
| |
|
||||||| |
|
|
| T |
35873095 |
atatcac |
35873101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University