View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15595_high_8 (Length: 285)
Name: NF15595_high_8
Description: NF15595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15595_high_8 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 29607178 - 29606882
Alignment:
| Q |
1 |
ctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607178 |
ctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgt |
29607079 |
T |
 |
| Q |
101 |
ggggtggcggtggttctggcgcatcatcttcaggcgatggtgct------------ggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607078 |
ggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaat |
29606979 |
T |
 |
| Q |
189 |
tgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggtgtttctttgtctggtgcgggtgctggtgct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606978 |
tgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggtgtttctttgtctggtgcgggtgctggtgct |
29606882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 226 - 279
Target Start/End: Complemental strand, 29606881 - 29606828
Alignment:
| Q |
226 |
ttctttttgtgtgtaggtgctggtgccggtgtttctttgtctggtgcgggtgct |
279 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | ||||| |||||| |
|
|
| T |
29606881 |
ttctttttgtgtgtaggtgctggtgctggtgcttctttggccggtgctggtgct |
29606828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University