View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15595_low_13 (Length: 252)
Name: NF15595_low_13
Description: NF15595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15595_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 43 - 237
Target Start/End: Complemental strand, 23924271 - 23924077
Alignment:
| Q |
43 |
taaatagaaagtgtacaaaattgaacattattagctgttttagagcctacatttatacttattttttagtatgaaatgttgtattaatgtattactcttc |
142 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23924271 |
taaatagaaaatgtacaaaattgaacattattagatgttttagagcctacatttatacttattttttagtacgaaatgttgtattaatgtattactcttc |
23924172 |
T |
|
| Q |
143 |
gagtcacctaacgagtgccgtatttataatnnnnnnnntgtcttaaaaatgtctgaaaatttatgggttcgaagctacgtctcaaaatataaatt |
237 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
23924171 |
gagtcacctaacgagtgctgtatttataataaaaaaaatgtcttaaaaatgtctgaaaatttatgggatcgaagctacgtctcaaaatattaatt |
23924077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University