View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15596_high_6 (Length: 254)
Name: NF15596_high_6
Description: NF15596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15596_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 33 - 249
Target Start/End: Complemental strand, 31584331 - 31584116
Alignment:
| Q |
33 |
attgaaaatgaaggatgttcgaattgggatgatccaaatgttaaatagtttgaatgtttgggctggccataatggaacatgcgtataagtgttatctatt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31584331 |
attgaaaatgaaggatgttcgaattgggatgatccaaatgttaaatagtttgaatgtttgggctggcgataatggaacatgcgtacaagtgttatctatt |
31584232 |
T |
|
| Q |
133 |
taaaatttgcaatacnnnnnnnccnnnnnnnngttacaatattacttaaattacacacatacacgtacatatattcttgcatgatatgatagaaatataa |
232 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| || |
|
|
| T |
31584231 |
taaaatttgcaata-tttttttccgagaaaaagttacaatattacttaaattacacacatacacgtacatatattcttgcatgataagatataaatagaa |
31584133 |
T |
|
| Q |
233 |
gtattgtttacatatat |
249 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
31584132 |
gtattgtttagatatat |
31584116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 214
Target Start/End: Complemental strand, 31582325 - 31582281
Alignment:
| Q |
170 |
aatattacttaaattacacacatacacgtacatatattcttgcat |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
31582325 |
aatattacttaaactacacacatacacgtacacatattcatgcat |
31582281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University