View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15596_high_7 (Length: 252)
Name: NF15596_high_7
Description: NF15596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15596_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 1460370 - 1460123
Alignment:
| Q |
11 |
gagatgaataattttctaaagacaactgattgatttggatttgg------tgaaatacggcccaacccaattcaagtgtaaaccttgcctatcgaaaccc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1460370 |
gagatgaataattttctaaagacaactgattgatttggatttggatttggtgaaatacggcccaacccaattcaagtgtaaaccttgcctatcgaaaccc |
1460271 |
T |
 |
| Q |
105 |
taattcttgttgcttttaaaagctattcgcttccaaccctaaccctgtttgtcaacctaatcatgaagaacaccttgccgtcgtaacagaatgtctcagc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1460270 |
taattcttgttgcttttaaaagctattcgcttccaaccctaaccctgtctgtcaacctaatcatgaagaacaccttgccgtcgtaacagaatgtctcagc |
1460171 |
T |
 |
| Q |
205 |
cggaaacttcaacggtggaggctgtggaggaggaggtagataggatca |
252 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1460170 |
cggaaacttcagcggtggaggctatggaggaggaggtagataggatca |
1460123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University